Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n10k16
Contig Information
Length 643 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n10k16   
Homology (BLAST) Top Hit hypothetical protein OsJ_023131 [Oryza sativa (japonica cultivar-group)]
Score 488
Evalue 1.64184e-47
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n10k16
GTGTTGTAGCTTCAGATCACATAAAACGAAAGGAATAATTTGTAATAGTACACCTGCAACAGCAATATAACATTACTTCTCGTATCAGAACTTAATAGGG
GGAAGCACCCATCAATGATGTGTGTGACATGCCGCTTCATTGTTTTAGCTGTTCAAACCGCATACAGGCGGATAATCTGGTTGATCTTGGCACGACAAAT
GGGGCACCCCCATTTCTTCGACTCGATATCCTTCAAGCAGGACATGCAACCAGCCATGTGACCACATGGAATGCAGGCTCCTTCCACAGGAGCATCCAAG
CAAATCACACAAGTACCAGAGGGGGTGTTACCACTGCTGCTTGCATCGGCTCCATTTTCTACAGGTTTTGCAGAGTTTAGCGCCGTACCACCACCTTCCG
TGGGTGGCATGGTTACATCAACTGGTGTGAAATCTATGGACGGATACTCAATAGGGCCATCGTAGAAGGTTCCTTCAGCAAGTGGTGGCGCAGTTGGTGT
TGGAAGAGTTGGAAGTACAGTTGGTGTTGGAACCGGAAGTGCAGTTGGTGTTGGAACCGGAAGTGCCTCANGTGTAATCACAATCGAANGGTTGTTGTTT
TGACTTTTGTTANGTTTCNATGAACTTTGGNNANAGCTTGNTC
page-top