Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20k05
Contig Information
Length 165 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20k05   
Homology (BLAST) Top Hit Os07g0570700 [Oryza sativa (japonica cultivar-group)] >gi|158513666|sp|A2YMU2|RRFC_ORYSI RecName: Full=Ribosome-recycling factor, chloroplastic; Short=RRF; AltName: Full=Ribosome-releasing factor, chloroplastic; AltName: Full=Protein OsL8; Flags: Precursor >gi|158513703|sp|A3BLC3|RRFC_ORYSJ RecName: Full=Ribosome-recycling factor, chloroplastic; Short=RRF; AltName: Full=Ribosome-releasing factor, chloroplastic; AltName: Full=Protein OsL8; Flags: Precursor >gi|34394208|dbj|BAC84660.1| putative Ribosome recycling factor, chloroplast precursor [Oryza sativa Japonica Group] >gi|113611583|dbj|BAF21961.1| Os07g0570700 [Oryza sativa (japonica cultivar-group)] >gi|218199871|gb|EEC82298.1| hypothetical protein OsI_26546 [Oryza sativa Indica Group]
Score 102
Evalue 5.78155e-07
Total Hit Count 47
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20k05
TTTTGTAGATCTGGGTGATAAATCCTTCACATTATCTTCAAAAAGTTTCTTTTCCTTCTCTAGCCTTATCGCAGGCTTTGANTGCATCTCGTCTTATGTT
TCTGATAGCAACCTTGCCTTCTTCAAATAACTNGGCTACCNGCTTTTGTCNNTTCCNTTCTGCGG
page-top