Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1o20
Contig Information
Length 404 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1o20   
Homology (BLAST) Top Hit plastid glutamine synthetase isoform GS2c [Triticum aestivum] >gi|73672739|gb|AAZ80474.1| GS2 [Triticum aestivum]
Score 651
Evalue 9.79166e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1o20
GGGAGGATCTGGAATTGACCTCAGAAGCAAATCAAGGACGATTTCGAAGCCAGTGGAGGACCCGTCAGAGCTACCCAAATGGAATTATGACGGATCGAGC
ACCGGGCAGGCTCCTGGAGAAGACAGTGAAGTCATTCTATACCCACAGGCCATATTCAAGGACCCATTCCGAGGAGGCAACAACATCCTGGTTATCTGTG
ACACCTACACGCCACAAGGGGAACCCATCCCTACTAACAAGCGACACATGGCTGCACAAATCTTCAGTGACCCCAAGGTCACTGCACAAGTGCCATGGTT
TGGAATCGAACAGGAGTACACTCTGATGCAGAGGGATGTGAACTGGCCTCTTGGCTGGCCTGTTGGAGGGTACCCTGGCCCCCAGGGTCCATACTACTGC
GCCG
page-top