Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n10o01
Contig Information
Length 757 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n10o01   
Homology (BLAST) Top Hit hypothetical protein OsI_08927 [Oryza sativa Indica Group]
Score 829
Evalue 3.72707e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n10o01
AGATGGCAGACCGGGAAGTTTCCAAGCCACCACGACTCTGCAGCAGAACTACAGCCAAGATCCAAGTCAACGGAACCGACGCGACATGTTTTTTCTTCAT
TCATGGACACTGGACGTCTAATGTTTCGACAGCAAAAGAAAACCTAATTACGCAAGATAGCGGTAGAGCTTCCTATCTACCTTGTCCCTCTCCAGGAACT
CGCGCTCGATCAGGGACTCGATCCTCTTCTTGATCACCACCGGGTTCGGCAGGAAGCGCGCCTGGAGCTGCTTCGTCACCTCCGTCACTATGCTGTTGTG
GTCCAGGACCCTCCTGGACTTCATGATCCTCACGATGGCCGCCTCGATCTGGGGCTTCCGGTCCTCCTCGACCCTGTGGCGGGTCTCCTGCTTCTCTGGC
TCTGACTCCTTCTGCGCAACGACCGTGCCAATCTTCACCTTCACCAACTTGCTGCTGAACTTGTCGTTGAAGTGGAAAGCGTCGCTGTCGGATATGTCCT
TGCTCATGGGCTCCTTCCGCAGCACGTTCTTGCCCTTCACACAGGCAAGAGACTGGAGGCAGCGCTTCAGATCAACAGGTGGTATGGCTGTGTTCTGCTC
AATTTCCTTGTAGGTCAAAGTATCTGTTGAGTTGAATAGCATCAGGACACACATCTGGTAAGTCGAGACATTCAGCTCATGCTTGCGGTCTCCAAAATGT
TGCCTTGATGTCTGCATTCCCCATATTTGTCTGCCATGTCAGTCTCCTGCCATTGTG
page-top