Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1a10
Contig Information
Length 111 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1a10   
Homology (BLAST) Top Hit transducin family protein / WD-40 repeat family protein [Arabidopsis thaliana] >gi|5103845|gb|AAD39675.1|AC007591_40 Strong similarity to gb|AF096285 serine-threonine kinase receptor-associated protein from Mus musculus and contains 5 PF|00400 WD40, G-beta repeat domains. EST gb|F14050 comes from this gene. [Arabidopsis thaliana] >gi|21536836|gb|AAM61168.1| Similar to unr-interacting protein and contains WD40 domains [Arabidopsis thaliana] >gi|24030339|gb|AAN41335.1| unknown protein [Arabidopsis thaliana]
Score 109
Evalue 0.000699389
Total Hit Count 60
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1a10
CTCGCGGCCGGTTCGTCGACCTGTTTCTACAGCCCCGTTCACGCCCGACGGCTACTTCCTCATCAGCGCCAGCAAGGACTCAAATCCAATGCTTCGCTAA
TGGTGAGACTG
page-top