Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20k08
Contig Information
Length 774 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20k08   
Homology (BLAST) Top Hit Putative RNA-binding protein [Oryza sativa (japonica cultivar-group)] >gi|125584982|gb|EAZ25646.1| hypothetical protein OsJ_009129 [Oryza sativa (japonica cultivar-group)]
Score 93
Evalue 0.000106188
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20k08
TATCTTATAAGACGCGAAAACAGCTCCAACTCTAGAACCCACTTTCAGATCCACTCACCCAACACTCGAACACAACACATAGTACTTACTCAAACACCAC
CAAATACCGAAAACAGACGCGACACAACCACGCCAGGCCACCGGGTACGGCGGCCTGGCGACACTACCTTTGTCTTGCCACAGGTTCTCTTTTCTCTTTT
TCTGGTGATTCCNATGATACCACTATAGGAGGAGTCTTTAGAGCTAAGCAAACTGAAATACGGATAATACGACGATGACAGGAGAAAAAGAGAGCTAGGG
AATAAACCTAACTATCCAACCCGCTTTCCAGCCACCTTTGGTGATCGGTACTTGGGACCCTGCATGTCTCGCCTGGTTCGCCAGCACCGTCCGTTTGTTC
CTCATGGCTAGCTGGGAGGATCAGGTATGCGATCANGCAGCTACACCGGTCTTGACAGCACCGTTGGCGACGACAGGCTTTTTCTCGGTGGCCACAGGCT
TCTTCTCGGCCGCTGCTGTTTGGGCCACCTTCGCCGCGTAGGTCACAGCTGGAGGAGCAGCGGCAGCGGCTTTCTCTGCCGGAACCTTCGCATCCCCGTT
GACACCATTTGCTACAGGTGACTTTGGCTTCCCATTGACAGCATCCTGCTGTTTCTCCCCATTGACACCGTTCGGTAGAGACACCTTTGGCTTCCCGTTG
GCGAGTTCTTGCTGTTTCTCTCCGGCAACAGGGATTCGGAGCCCTACTGTCCCACACCTGCTTTTGGATCTGCT
page-top