Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1n08
Contig Information
Length 526 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1n08   
Homology (BLAST) Top Hit hypothetical protein OsI_15088 [Oryza sativa Indica Group]
Score 796
Evalue 1.87334e-83
Total Hit Count 347
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1n08
CCGCATCCTGGGACCAAGTCAGGGTCCATGGAAGAGGAGCTGGTGCAAAGAATCAAGCAGCAGGGTTTGCATATAACACCAAAGATTCTTGTGCTAACAA
GACTGATACCAGATTCCAAAGGCACAAAATGCAATGTGGAGCTCGAACCGGTTGAAAATACAAAATATTCACACATACTCCGTGTGCCATTCAAGACTGA
AGACGGGAAAGATTTGCGCCAGTGGGTGTCTCGGTTTGACATTTACCCGTACCTAGAGAGATATACTCAGGATGCTTCTGCCAAGATCCTTGACATTCTA
GAGGGCAAACCAGACTTGATCATTGGCAACTACACCGACGGCAACTTAGTGGCGTCCCTCATGTCGAGCAAACTAGGTGTCACACAGGGAACAATTGCAC
ATGCTCTCGAGAAGACGAAGTATGAGAACTCAGATGCCAAGTGGAGAGAGCTGGACCAAAAATACCATNTCTCCTGCCAATTCACTGCCGATATGATTGC
CNTGAACACTANCGATTTTATCATCA
page-top