Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1n05
Contig Information
Length 160 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1n05   
Homology (BLAST) Top Hit polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 140
Evalue 9.01707e-09
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1n05
TCCGATCGACCCCAGGCTCGTCGAATCCTCCTCCCCCACCGCCTCAAGATGCAGATCTTCGTGAAGACCCTCACAGGCAAGACCATTACCCTTGAGGTTG
AGAGCTCCGACACCATTGACAATGTCANAGGCCAAGATCCAGGACAAGGAGGGCATTCCT
page-top