Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20p05
Contig Information
Length 827 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20p05   
Homology (BLAST) Top Hit hypothetical protein OsI_24463 [Oryza sativa Indica Group]
Score 750
Evalue 1.13385e-77
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20p05
GAACGGGCAATGCGCCCAGCCTTTACACACACAATCAAGATACAACAAATGTCTGTCATGGTTGCGATTTCGATACACCACATCTAAGGTAACAACAATT
CACGATTGGGTTTGCACTACGAATCACGGACCCGGGAACAGGGCATCATCGTCGGTTATTCTGGACCCCCAGGGATATAACTTCTTTTTCTTTTCACTGC
CGCGGCAATGTAACTGTAAGTGACATCAGTTGGACAAGAGCAGGTTTCTTATCTGGTGTATCTGTCTTCTGCTAGTTTGGACGGTTCAGAGCCATGAACT
TGCACTGCTCACTCATCGCCTGGAGCTGTGCATCCTTCTTGTCGACCATGGCACGTAGCCTCACATTTTCCTCCATCACCTTCTGGACTTCAGCTTCTTT
CTGTGCCTTCTCAGTCTCGAGCTGGTTGGTCCTTGCGACTAGCCTGTCAAAAAGCTTCTCCATTGTCTCGAATTGCTTCTCCGATGAAAGAAGAGTTTCT
CTGACACTAACGAGTGTGCTGACATAAGTTCTGAGCGACTCAAAGTCGTTCTTCACACGACTAAGCTCCTGCTCATTTTCAGCAGCGCGCTGCCTCTGCC
GAGTGGTCTCCAGCACCATATCTTCAACCCGCTGCCTCATCTCATTCAGCATACCGTTCGTACCCACTGCAAATTTCTCCATCTCCTCGACTTTGACCGA
CATGGACTCGACCTGAATGGTCTTCCTCCTGATCTCTTCCAACCCAATCCTCACCTTTTCTTTCTCATTCNCAGTTTCGGACTCGGCCACAATCACTCTC
TTGACAANAGACTCCATGAACGTCGGT
page-top