Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1l24
Contig Information
Length 737 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1l24   
Homology (BLAST) Top Hit Os06g0665100 [Oryza sativa (japonica cultivar-group)] >gi|52076506|dbj|BAD45384.1| Dreg-2 like protein [Oryza sativa Japonica Group] >gi|113596343|dbj|BAF20217.1| Os06g0665100 [Oryza sativa (japonica cultivar-group)] >gi|125556388|gb|EAZ01994.1| hypothetical protein OsI_24026 [Oryza sativa Indica Group] >gi|125598147|gb|EAZ37927.1| hypothetical protein OsJ_021410 [Oryza sativa (japonica cultivar-group)] >gi|215715261|dbj|BAG95012.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765651|dbj|BAG87348.1| unnamed protein product [Oryza sativa Japonica Group]
Score 643
Evalue 2.3476e-65
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1l24
TGGACGAGCACCGCCGGTATTCCGCTCCCGAATTCCACAGATTTCCACTCCCCGCTCCCAAAGCCCCGAGACTTTATAGCCGGCGAGAACAAACCCAGCA
AAATCCCATCTCCCAACCCAGAAATCCTCCCACACCCAGAAATGAATCAGCCTCTCCTTCCCCTTCTCTGAGATCTCAGCCTGAGCCTGCGCGCCGCGAC
TTCCACCGGAATCCTCCTCTCCCAGCCGCAGCGTCGCCGGATTGATTCAGGAGGCATTCTTGCCGGCCGGAGAAGCAGTCTTTGGTCATCTGCTCGAGAA
GAATATAACAGAGGCTCTAGTTCAGATCATCATCAGACATGTCGCTGCTATCGAAGTTACGGTTGGTCACTGTGGATGTGACTGGTACTCTGCTTGCTTA
CAAAGGACGGCTTGGTGATTACTACTGCATGGCTGCTAAGTCTGCCGGAAAGCCATGCCCTGACTATGATCGAATGCACGAAGGCTTCAAGCTTGCATAC
ACTGAGATGGCGAGGAAATACCCATGCTTTGGATTTGCGGCAAAGATGCCAACGATTGAATGGTGGAGGATTTGTGTCAAGGATTCATTTGTTAAGGCTG
GCTATGATTACGATGATGAGACATTTGACAAAGTGTTCAAGCGTATTTATTCCGCCTTCGGCTCCTCCGCACCATACTCGGNGTTTCCTGATGCACAGCC
CTTCATGANAGGGCTGAGGGAGAAGGGTATCACAGTT
page-top