Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1b14
Contig Information
Length 603 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1b14   
Homology (BLAST) Top Hit hypothetical protein [Plasmodium berghei strain ANKA] >gi|56497062|emb|CAH96275.1| hypothetical protein PB103359.00.0 [Plasmodium berghei]
Score 80
Evalue 2.88868
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1b14
GATGGTGATCTAGCTGATCATGCTTCTTAGCCGCTATTAGCGGGCGAAGGCGAAGCGTGTACAAGTATATACATAGAAAATAATTCATCTACACAAGCCT
TCAGAACAGGGTAGATTTCCTAGAAGGCGACACCCAATAGGTCATTTCTGTACCCAGGTTTCCTTGCAAGCTTATAATTATCAAATTCTACTACAGTTTA
TATTTGATGCATGAAATTGACCTCTTAGCAATCACCGGTTCAACAATCTTTGTATTATATGCAACCATCAGGCTTATGCATATAATCGTTCAGGTCCTGA
TTTTTTAAATTAAATATTCTTAATGTTGAGCATTTTTTGTCACGGATTCAGTTCATTATTCAGGATCACAAGAGTCCAATTCTTATGTGGTTCAGTAAGC
ACCAATGATAATACGAGTTAGACGGCTATACAACTCGACTTATCTACTGAAACAAGATGTTTAGCGGATCAACAAAATGCTTACAGATATAGAACAGCAG
GAGGGTGAGGTGTGGGTATAACGTGGCAAATGATAGACCCGGTGAACAAGGAATGACAGTTGTGCAGAGGGTTAAGGGGTGTGGTTACAACGTGACAATA
AGA
page-top