Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1l18
Contig Information
Length 314 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1l18   
Homology (BLAST) Top Hit hypothetical protein OsI_33456 [Oryza sativa Indica Group]
Score 359
Evalue 6.9382e-33
Total Hit Count 324
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1l18
AACCTTGGAATTTGTCCAAAGTTGAGTGTTCTACGCATAGAGGCCCCAAATATGTCTATATTGGAGCTGAAGGGCTGTGGTGTCCTTTCTGAGGCTTCAA
TTAATTGTCCTTGCTTGATATCTTTAGATGCCTCTTTCTGCAGACAGTTTATGGATGATTCGCTGTCCCAAACAGCAGAAGCATGCCCTCTTATTGAACA
TCTTATATTGTCTTCATGTTTATCCATTGACGTCCGTGGATTGTCTTCTCTGCATTGCCTTCANAAGCTGGCCTTGCTTGACCTATCATATACATTTTTG
ATGAACTTGAANCC
page-top