Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20o16
Contig Information
Length 338 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20o16   
Homology (BLAST) Top Hit mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|215768991|dbj|BAH01220.1| unnamed protein product [Oryza sativa Japonica Group]
Score 461
Evalue 1.03778e-44
Total Hit Count 309
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20o16
CGCGGAGCGTGTGGGCCATTGCAACCTGCTGCTTGTTCACCCCCTCCNTTATGCAAGAGAACGCTGCGAAGGTGGCGCAGCTCTGAAGCATGGCTTGAGG
TGTTCCTGGAAAGCTCAAGGCAAGGCCAGTGCAACATCCAGCAATGCCAGAATTGACAAGATCATCTTTTCCGCGTAGCTTTTTCAATAAGCACACAATA
AAACTCTGGATGCCGGANAGAACTGCAAAAGTCTTGGCAGCAGAGCCTGCATTGCTGAGTGAGCCCTTGAAGCCCTTCTTANTGATCAAACCTTGCCCGT
ATCCAACGACGCCTCCAACCGAAGGCGCCGGCGCNGAA
page-top