Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20n22
Contig Information
Length 490 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20n22   
Homology (BLAST) Top Hit hypersensitive response protein [Triticum aestivum]
Score 694
Evalue 6.92051e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20n22
GNCCCANTGNNCTTCATGGTATCGNAGNACTGCGTCNCCGGAACCATATCCATGACATCCTTCGAAGAGGTCCCANGCACATTCTCAGAGAAGGCGAGAA
CACTGTCTCTCAGCCCGTCCACTATGGCCTGGCGCTGCCTTGCAATACCCACACCAGCCAAGTACTTCGATTCTGCCTCACCTTCAGCCCTCTTGATCTG
GAGTATCTTCTCCGCTTCCGCTTTCTCAGTGGCTGCCAACCTCATCCTAGCAGCTGCATTGATCTCATTCATGGCTCTCTTCACATGTTCATCTGGCTCA
ATATCAACAATCAGAGTTTGCACAATCTCGTACCCGTAGGCAGACATTGCCTTTTCAAGTTCATCCTCCACAGCCCTTGCTATTTCATTCTTCTGCTCAA
ATACATCATCCAAGTTCATCTTTGGAACGCTAGCCCTGATCACGTCAAAGACATAGGGACTGGATTTGCTCCCTGGTGTTGCTAANCCTG
page-top