Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1k08
Contig Information
Length 363 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1k08   
Homology (BLAST) Top Hit Os01g0896800 [Oryza sativa (japonica cultivar-group)] >gi|122222375|sp|Q0JGY1|RL51_ORYSJ RecName: Full=60S ribosomal protein L5-1 >gi|56785265|dbj|BAD82174.1| putative ribosomal protein L5 [Oryza sativa Japonica Group] >gi|113534614|dbj|BAF06997.1| Os01g0896800 [Oryza sativa (japonica cultivar-group)] >gi|169244415|gb|ACA50481.1| 60S ribosomal protein L5 [Oryza sativa Japonica Group] >gi|215737756|dbj|BAG96886.1| unnamed protein product [Oryza sativa Japonica Group]
Score 407
Evalue 1.90312e-38
Total Hit Count 371
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1k08
CGCGCCATAGAAGCCGCCGCCGCCGCCGCAGCAGCAACAGCAGGCGAGCGAGATGGTGTTTGTGAAGAACCAGAAGACCAGGGCCTACTCCAAGCGCTTC
CAAGTGAAGTTCAAGAGAAGGAGACAGGGGAAGACCGATTACAGGGCCAGGCTCAGGCTCACCAACCAAGACAAGAACAAGTACAATACACCCAAGTACC
GGTTTGTTGTACGATTTACCAACAAAGATGTCACTGCCCAAATTGTGTACGCCACCATTGCTGGTGATATCGTGATGGCTGCTGCCTATTCTCATGAGCT
TCCTCGATATGGTCTTGAAGTTGGCCTCNCCACCTATGCTGCAGCTTACTGTACTGGTCTGCT
page-top