Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1k04
Contig Information
Length 142 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1k04   
Homology (BLAST) Top Hit Os02g0793500 [Oryza sativa (japonica cultivar-group)] >gi|47497144|dbj|BAD19193.1| hypothetical protein [Oryza sativa Japonica Group] >gi|47497591|dbj|BAD19661.1| hypothetical protein [Oryza sativa Japonica Group] >gi|113537901|dbj|BAF10284.1| Os02g0793500 [Oryza sativa (japonica cultivar-group)] >gi|125583983|gb|EAZ24914.1| hypothetical protein OsJ_008397 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 239
Evalue 5.72001e-19
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1k04
GCTCCCACCTAGCAATTCACGTACTCCGCCATGGCCCCAGACCGTGATGGCTTCCTCCGCCACCACCGATCGCGCCCTTCCAGGGGCTCAAGTCGACCGC
CGGCCTCCCCGATCAGCCGCCGCNTCCGGCAGCGCCGGNCTC
page-top