Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1g12
Contig Information
Length 164 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1g12   
Homology (BLAST) Top Hit Os03g0337500 [Oryza sativa (japonica cultivar-group)] >gi|113548519|dbj|BAF11962.1| Os03g0337500 [Oryza sativa (japonica cultivar-group)]
Score 220
Evalue 9.27371e-17
Total Hit Count 239
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1g12
AGCCGATTGTTATGTGTGATTGATTGATTTCTGGAGCAATGGATCTTGAGTTCGGGAGGGGCATGAGATCCCCGCAGAGGGACTCATGGAAGACCACCAT
GCTGCTGGCATACCAGAGCCTCGGGGTGGTGTACGGGGACCTCAGCATCTCCCCTCTCTACGTC
page-top