Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1j08
Contig Information
Length 431 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1j08   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195609644|gb|ACG26652.1| GTP-binding protein SAR1A [Zea mays] >gi|195653011|gb|ACG45973.1| GTP-binding protein SAR1A [Zea mays]
Score 405
Evalue 3.26601e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1j08
CGAGCCAGCGAGGGGGAGAGAGAGAGAGAGAGAGAGGAAGAGGCGAGCGTCGACCGGTCGTTCGGTGTGAGGAGGAAGAGGAAGANATCGCCGGAGAAGA
GGAGGCGGACGAGAAGAGATGTTTCTGGTGGATTGGTTCTACGGGGTGCTGGCGTCNCTGGGGCTGTGGCAGAAGGAGGCCAAGATCCTCTTCCTCGGCC
TGGACAACGCCGGCAAGACCACCCTCCTCCACATGCTCAAGGACGAGCGGCTGGTGCAGCACCAGCCGACGCAGTACCCGACGTCGGAGGAGCTGAGCAT
CGGCCANATCAAGTTCAAGACCTTCNATCTCGGTGGCCACCANATCGCCCGCCGAGTCTGGAAGGACTACTACGCCAAGGTGGATGCGGTTGTTTACTTG
GTGGACNCTGCTGACAANGAACGGTTTNCAG
page-top