Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20l04
Contig Information
Length 125 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20l04   
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain clone 512; Short=RuBisCO small subunit >gi|21866|emb|CAA25057.1| unnamed protein product [Triticum aestivum]
Score 215
Evalue 3.52185e-16
Total Hit Count 419
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20l04
TGTGCACCNGAANATAGGCAGCTTCCACATTGTCCANTANCGGNCATCGTAGTACCCAGGGGATGNGTTGTGCTCACGGAAGATGAANCCAACCTTGCTG
AACTCGAGGCAAGGCACCCATTTGG
page-top