Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20l13
Contig Information
Length 817 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20l13   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 306
Evalue 3.38864e-26
Total Hit Count 455
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20l13
TCGCCGCCAGTTTAGGGATCATACATGCATTTTACTCAGGTCTTCAGTGACTTGGTACACTTCATCACAAATTTCGTCCACAGCTCTTTTCCATCTGGTT
ACTGCAGAATCTACTACACTGGTTGTTGGTGCATTGCTGCATGCTGCAATGTGCTTCCAACTCTTTGCAACATTGGGCCAGCACAGCACAGCACTGCAGC
AGAATCATCAGTCAGGTGCAACAACCGTACCCTACTGCTGCCATGCACTATTAACCGCACAGCAACATCCATCAGATTACAGGACGCGCCAATCACCGTC
TTCTTTACATCATGTGTACAGCACAAACATACCCCCGGCATCTTCCATTCCATCTCCTACCTCCCCCGACCCACAAAATTAGACGACGAACCATCGGTTT
CGGTTATCATGTCATATACTCCTCTGGTACCTAGGTTTCAGGTTAGACAGCCCTCTCTCTTCCCAGCGAGCTGCCGCCGCCGCGCCAGACGGGTCGGAGC
CGGCGTGGCTCGGCCACACCAGAGGGACCACCGGCTGCTGGTACGCGTCGCAGGCCCCCAGCTTCACCACGAACGTCGCTGTGCAGCCCTTTCCCGCCCC
GTCGCTCTCCAGCCATATGTGCCCACCCATCAGGCTCACAAACCTCTTGCAAATGGCGAGCCCGAGGCCGCTGCCGTTGTACCCCTGGTTCCCGCCGCTC
TGTGTGTGAGCAAACTTTGTGAACACATGGGNATAGGTCCTGGGAGCTGATGCCGCACCCTGTATCTTTAACCTGAACTTTTACATAGAAATGGCCATCA
GTCGCCAACCGGAATGG
page-top