Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1c11
Contig Information
Length 680 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1c11   
Homology (BLAST) Top Hit hypothetical protein OsJ_007265 [Oryza sativa (japonica cultivar-group)]
Score 253
Evalue 3.31976e-20
Total Hit Count 166
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1c11
AACGCAAACTCCGTTCGTTCCCCACCACCATCTCGTCGAAAACCTAGAAATTCGGAGTGAGATTGTGTTCGTCCGTTCGCTTTCGTTTCTTCGAGATCTG
TGAGGAGGGGGGAGAGACAGATCCGTCGCTTGCTCCCTGTTCGAGGTTTGTGACGAGGACGAGCAGCAGATTCGACGCGCGCCTCCGAGGTTCTTCCTGG
AACTAATTTGATGTGCTATGGAATCCAAGGGTGGTAAAAAGTCCAGCAGTAGTCGTTCCTCCCTCATGTACGAAGCTCCCCTCGGCTACAGCATCGAGGA
CGTCCGCCCTGCAGGAGGCATTGAGAAGTTCCGCTCCGCTGCCTACTCAAACTGCTCCAGGAAGCCATCCTGATAATCCCTCTCGCGCCCCCATCCTAAT
TGCTTAGAATTCCCTTCTGCTTTCAATTCATCTTCCTAAAATTTCTCTGGCTAGCTGCTTTTCTCTGACCAGCAAAGCCTTTCCTCCTCTACCAACCTTC
TCAAACAATGGCCGTCTCTGCGATTGGGTTTGAGGGATATGAGAAGCGCCTGGAGATCACCTTCTCTGAAGCGCCAGTCTTCACTGACCCCAATGGCAGG
GGATTGCGTGCTCTCTCTCGTGCCCAGATCGACTCGGTTCTTGATCTTGCCAAGNGCACCATTGTATCTGAGCTCTCTAA
page-top