Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1h24
Contig Information
Length 352 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1h24   
Homology (BLAST) Top Hit DRP2 protein [Triticum turgidum subsp. durum]
Score 115
Evalue 0.000139263
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1h24
AGTCGTATTCGGCTTCCCGGAGTGTGGGGCAGAAGCTCACAGACTGACTGAGATAGCAGCAACTGGTTTAGCCCCAATGCTCTGTATGTTATCGCGTCGT
CTTGCCGCCTCCCTGCCCTGCTGTTGTTGTGTTATATGTGCTGCCTAAAGCGTGCCATATGTGTATCACTTATTTCGAGTAGAGGACATGAATCCGTGTA
TAGTTATCCCGGTTTAGCGTAAGGTACCACCAGTCGCCCCTGAACTTTCGGCACCCTGTGTTGTAGTATACTCATAGTAACGAATAAGGCAATAATGCCG
GCTGTGTTGGCGAGTGCGGGCTAGGTTGTGGTTTTGTGCTGTAAAAAAAAAA
page-top