Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20m05
Contig Information
Length 822 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20m05   
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 583
Evalue 2.58912e-58
Total Hit Count 99
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20m05
ACGTAATCACAAGGTGAGCAGCACAATGGGTCACAAGGGAGCAGCTTGACTCAACAGATCAAAAGCACGTACTACAACAGACACCATTCAAACACCAGAT
CGAATAGAAAGTCTTGAGAGTACCTTTTATTCATTATTTATTATATATTCCCCAACAAGGCAGCACAACACCGATGTCTTCTTAACTCGAGGCTATCGTT
ATTTTGTACTCCTGATAGTTACGCCTGATAACTTCGATCCTCGGTCGCGTCTAGAAAGGTGCACACACATCACTCAGCAGCCTTTCCTTTCCGGCGGTTG
CTGCCGCCTGCGGAGGCTCCGGTGCCTCCCATCTCCACCAGGTAGCAGATCATCGAGTCCATGTCCTCTCCGAATATACTGTAGGCTTCCATCACTTGCA
TGTAGCTAAAGCCCATTGTCAGAAGCAACTGCATGCTGCGAGTCAGCACCGTGTCTGGGAGTACGAAACAATTCTCGCTGCCTCTATCCGCCGCCGAACC
AGACGATCCACTAATTGCGGCGGACGAAGATGGCTCTGCCCCTGACCTTGATGACTCTCTGAAGTTAACTTGCTGCTGGTTCAGATACTCTGCCCGAGAG
GCCTCCATCACCATCCGCTCTATTTCCTTCTCAGTTAACTCCAGATCAGAGTAGAGTCGCCCTTCAGCCAAAAGTGCGTTCTCAATCTGCTGATCTTGCT
GAGCTTTTATTGCAGCCTTCACTTGGTCTCTGTCAACACTGTTGGTCCCTCTAAGGGAGCTAAATCCAAGGCCTGCCCCAACTGTCANCCGACGAGGATC
AACAACTGAATTATAATGGTTA
page-top