Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1d20
Contig Information
Length 576 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1d20   
Homology (BLAST) Top Hit hypothetical protein OsJ_022593 [Oryza sativa (japonica cultivar-group)]
Score 818
Evalue 6.84795e-86
Total Hit Count 231
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1d20
GTCGGCCGGCGTCGGCCAGTTCCTGTTCATCAGCAGCGCCGGGATTTACCTTCAAACCGACGAGCCGCCGCACGTGGAGGGGGACGCCGTGAAGGAGAGC
GCCGGGCATGTGGGCGTGGAGAAGTACATCGCGGCTGAGTTCGGCAGCTGGGCGTCGTTCCGGCCGCAGTACATGACCGGCTCCGGCAACAACAAGGACT
GCGAGGAGTGGTTCTTCGACAGAATCGTGCGGAAGCGGCCGGTGCCGATCCCGGGGTCGGGGATGCAGCTGACCAACATCTCCCACGCGAGGGACCTGGG
CAGCATGCTCACGCTCGCCGTCGACAACCCCGACGCCGCCGCCGGGAAGATCTTCAACTGCGTGAGCGACCGCGGCGTGACGCTCAACGGCCTGGCCAAG
ATGTGCGCGGCGGCCGCGGGCGCCACCGTCGAGATCGTCAACTACGACCCGGCCGCCGCCGGCGTCNACGCCAAGAAGGCCTTCCCCTTCCGCAACATGC
ATTTCTACGCGGANCCTCAGGCGGCCAAGGAGGTGNTGGGATGGACNAGCACCACCAACCTGCCNGAGGACCTCAA
page-top