Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1e01
Contig Information
Length 328 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1e01   
Homology (BLAST) Top Hit 20S proteasome beta 5 subunit [Triticum aestivum]
Score 336
Evalue 3.29009e-30
Total Hit Count 325
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1e01
GTCCGTGGGTCGAAAGAGAGAGGAAAAGCTCACTTCATCGCCTCAGCCTCCGCCCCGCCGCACCCGCCGACGACGCGATGATTCCCAACCTCTCCGCCCT
CGAGAACCACTTCGGCGCCGCCGCCGCCGGCAGCGACGACTTCGCCGGCCTCTTCTCCGCCGACGCCGCCGGCCAGCTCGCCCTCGAGTTCCCCACCTGC
AACGACTTCGATGGGTTCCAGAAGGCGACCAAGGAGATGGTGAACAACAAGAAGGGGACCACCACGCTCTCCTTCATCTTCGACAAGGGCGTCATCGTCG
CCGCCGACTCCCGGGCCAGCATGGGCGG
page-top