Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1f02
Contig Information
Length 259 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1f02   
Homology (BLAST) Top Hit RecName: Full=GDP-mannose 3,5-epimerase 1; Short=GDP-Man 3,5-epimerase 1; AltName: Full=OsGME-1 >gi|125531932|gb|EAY78497.1| hypothetical protein OsI_33589 [Oryza sativa Indica Group]
Score 296
Evalue 1.44103e-25
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1f02
CGCCGCCGCCGCCGCTGTCATCGCCGGCTCCGCCTCCTTCCCGCCGCCGACTGTCCCGACAACTCCCGCAAGAATGGGGAGCACCGACGAGACTGGGACT
CCCTATGGCGAGTACACCTATGCTGAGCTGGAGAGGGAGCTGTACTGGCCATCCGAGAAGCTGAGGATCTCGGTTACTGGAGCTGGTGGTTTCATTGGAT
CCCATATCGCTCGCCGCCTGAAGAGTGAGGGGCACTACATCATTGNCTCTGACTGGAAG
page-top