Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n1g01
Contig Information
Length 438 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n1g01   
Homology (BLAST) Top Hit hypothetical protein OsI_24000 [Oryza sativa Indica Group]
Score 649
Evalue 1.64087e-66
Total Hit Count 260
Registered year 2003
Contig Sequence     [ Download ]
>whv3n1g01
CTAGTATGGAGCCTTAGATACCCAGAGTTTGGATATAAACAAGGAATGCATGAACTCTTAGCTCCTCTGTTCTATGTCCTTCACATTGATGTGCAGCACT
TTAAACAAGTTAAGGAGCTTCATGAAGAGCTTCTTGGTGACGATTTTGATGGCCAGACATTTCCAGATAGGTTTTTGCTGAACAGGAGTGACAGGGCTAA
CAATTCTGAGGGTGGTGCAGCTAAAATTAGAAGTTTGGACGAGCTTGATGCTGGTACTAGGGACCTCCTCTTGATAAATGATGCATATGGAGCAGAGGGT
GAGCTAGGTATCATTTTATCTGAAAAGTTCATGGAGCATGATGCCTATTGTATGTTTGAGAATTTGATGAACGGGTTGATGAATGGTGCACAAGGTGTGG
TTGCTATTACTGATTTCTATTCTCTCAGTCCTGCNTCA
page-top