Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20m20
Contig Information
Length 730 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20m20   
Homology (BLAST) Top Hit hypothetical protein OsI_38684 [Oryza sativa Indica Group]
Score 348
Evalue 3.71657e-31
Total Hit Count 113
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20m20
TACATGTGAGGCTGTTTTATTGGATGCTCACAAGAATGATGATGACAAGATGTACAGGGATCACCTTAACATATTGTATAATGTTTATTTTATATATGGC
AATAAAATAAACAACAATATAAACCAACTCTTTGGACTCAGACAACCTACCGGACAAAATTTCTTACAGATTGAATGAACAAATGTAACTGTACAAGGAA
ACACCTCTCTGGACTCATCAAGGACGCCAGCCAAATTTTTGTATTATGAGCCTCAAAGCTGACTGTACGAAGCCCGATGATTCTTTGATGCACCTATAAC
GGAAGAGAATTTTTTGGGGGGAAAGATGGTGATGAAGCTACAGCTTGATGTCTCCAGATTGTACATGGACAGAAACATGAAAGGATGAATATTGGGTGCT
ATATGCATTTACGCTGTCGCGAGGGCATGGTACCTAAGGGTGGATGAGCAGATGGAGGAATTTGATGATTGACTGTGGAGGTCAGAACAANCCTCGGGAA
ATACCGACTCGGAGTATCCAGAAACGTTGGAGCAAGACCAAGAGGCAGAATGCGCTGAATCAGCTATGGTGAAATTGATATTGGAGAGGCAGATATTGGT
GAAAGGATCGCCATCGATTCCCGACAAAACTCCTGCCAACGAAATGTTTATTCCAACCATGTCTTTTAAGGTGATTCCACTGATCTCCGGGAGTGCAGAC
AAATCAAAATGTTCNTCCAGGATGGCTTGA
page-top