Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20m10
Contig Information
Length 800 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20m10   
Homology (BLAST) Top Hit RecName: Full=V-type proton ATPase subunit B 2; Short=V-ATPase subunit B 2; AltName: Full=Vacuolar proton pump subunit B 2 >gi|167110|gb|AAA81331.1| vacuolar ATPase B subunit [Hordeum vulgare]
Score 874
Evalue 4.49575e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20m10
CATCTTCGGGCATGTACGCGCCTAAACGGCTTTTCAGTTTTGCTGCACAATACAGGGAAATGAAACCAGAAAGAGGTCTAGCTTGTGAATGGAAGCTACA
TGGGATTACAAAGCTGCCAGTGCACAAGACATGTGGGGTACAACTTGTGCATACAGACTGGAAAGAATAGGATCTGACTATATAACGTAGCAAAATGATA
CAAGTTTGGATTCTTCTCTTATTCAAGCTGTTCATCATGAAAAAAATGGACTTTTATGAACAAAATGGATCAATGGGTGGCATCTCTGCTGTAGAACTGA
TCCAAGGTCTTCGCAGGAATACGGTGGAGAAGTTCACGGGGGAATATGCGTAGCAATGTCCATGCCAGATCAAGTGACTGAAAAATGTTCCGAGTATCGT
ATGCTCCTTGCGCTACAAATTTCCTCTCAAACTTATCGAGGAATTCTAAATAGAGCAGGTCCTCAGATGAAAGAGCCTCCTCTCCGACAACTGCTTTCAT
GGCTTGAACATCCTTCCCAATGGCGTAGTTGGCATACAGCTGATTGGACACATCTGAATGATCCCGGCGTGTCATACCTTCACCAATAGCACTCTTCATC
AGACGAGAAAGAGATGGCAGGACGTTGATGGGTGGGTATATCTGTCTATTATGAAGCTGTCTGTCAATATATATCTGCCCTTCGGTAATGTATCCCGTAA
GATCANGAGTTGGATGGGTGATATCATCATTAGGCATTGTAANAATAGGAATTTGGGTAATTGATCCTTTTCTTCCCTCNATACNCCCANCTCGCTCNTA
page-top