Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20n15
Contig Information
Length 514 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20n15   
Homology (BLAST) Top Hit Os01g0802000 [Oryza sativa (japonica cultivar-group)] >gi|113534074|dbj|BAF06457.1| Os01g0802000 [Oryza sativa (japonica cultivar-group)]
Score 105
Evalue 0.00236153
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20n15
AATCTCTATAAAGACAAATATTTGGAACAAAGGGAGTATTTTACTACAGAATATACAGTAGTTCACACTGCTCACTCAGTAGACAGCTTACATTTTATAC
ACAGCTCCAGCCAACATAAGGTGAACGTTACAGGCACCCATCACAGATTCATCATATATATCTAAACTCCACACCACGCCTCCAGCTTGGAGCATATATA
TCTAAGCTTCACACAACGCCTCCAGCTTGGAGCAGGAGCTCAGGGAGTGTCACGGATCATAGTGCCACTCAGAGTAGGTTATCTGGCCAGGGTCGTCGTT
GTAAACCGCAGGCGCAGGCTCACCCCCGCCTCCTCCGTACTGGTAAGAACTGGGACCGGGGCTCGACGACCCAAACGGCCAGAGGAACGAGAAAGGGCTC
CCTCTGTCGTCGCCGCCGTTCCTCGTGACAGGCCCAGGGTCGGCTCCGGCACCGGTGACCCCACGGTTCACGGCTTCGCTGGCGTGGGCCGAAGGTTGTG
GGCGGGCTGCATTG
page-top