Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv16n14l06
Contig Information
Length 811 bp
Tissue Shoot grown under cold condition for 16days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv16n14l06   
Homology (BLAST) Top Hit hypothetical protein OsJ_022328 [Oryza sativa (japonica cultivar-group)]
Score 1315
Evalue 3.33806e-143
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv16n14l06
GGTGGGGCATCTCGTACGGGTCCAGATGCATACGAGGTTGCACTCAAACTCGAACATCGGAGAAGCAAAGGATGTAGTTATGGCCCCCCGTTTGAGTGGC
AGGTTTATCAGTCTCTTAATGGTTGTTATGGCATACCATCAGTCCACTACAAGGGTCGCCAGGGAGACTACTACATTCTCGTAATGGATATGCTTGGTCC
TAGCCTCTGGGATGTTTGGAATTCAATGGGACAGGCGATGTCTTCTCATATGGTTGCTTGCATTGCCGTTGAGTCCATATCAATCCTTGAGAAGCTTCAT
TCCAAAGGCTTTGTCCATGGAGATGTAAAGCCAGAAAACTTTTTGCTTGGTCAACCTGGATCACCTGATGAGAAGAAGCTTTTCCTAATTGATCTTGGTT
TAGCATCCAAGTGGAAAAAAGCATCATCCAGTCAGCATGTTGAATATGACCAGAGGCCAGACATCTTTAGGGGAACAATTAGATATGCTAGTGTCCATGC
TCATTTAGGCCGTACAGGCAGTAGAAGGGATGATTTGGAGTCACTAGCGTACACCCTTATTTTTTTAATAAGAGGAAGATTACCTTGGCAAGGCTTTCAG
GGAGACAACAAGAGCTTTCTTGTATGTAAGAAGAAGATGGCTACCTCTGCGGATGTTCTGAGTTGTTTCTGTCCACCTCCATTCAAACATTTTCTTGAGA
TGGTCACTAATATGAAATTTGATGAAGAGCCAAATTATGCAAAACTTATTTCTCTCTTTGATAGTCTGATTGAAGTGCCTGCTTCAAGACCCATCANAAT
TGATGGTGCTC
page-top