Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1802
Contig Information
Length 688 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp10b06    whdp6c19    rwhdp10b06    rwhdp6c19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit germin-like protein 1a [Hordeum vulgare subsp. vulgare]
Score 589
Evalue 7.052e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1802
TTTTTTTTTTGCGAGGCTAACTTATTCAATCGTATTACAACTGCATGCGAGCTTAACCAGAAGCTTGAATATACAAGTCGGATTATGTATTAGTATTAAA
TTTCGCTAGCATAGCATGCAGATCGGATTATGTATTGATCATCTTGGGCAGGCTCTTAGGAGGCCTGGAAAGACCCACCAGCGAACCTGGACTTGAGAAG
TTCGACCACCCCGGCGTCCACCCGGAGAGCCCTAGTGAGCACCGGCGTGGGGATGGGCGGGTTGGAGCCGAAGAGCGTGAGCGGCACGAAGACGATGCCG
GGGTTCTGGCTGTTGAAGGAGACGAACATGGTGGCCTCGGTGTCGCCGGCGTTGAACTGGAAGTGCATGAGGCCATGCGGGATGAGGAAGTTCTCCCCGG
CGCGCACCACCCTGGAGTAGAGCCTGTTCCCGGACTCGTTGCTGCCGATGATCCCCACGAGGAGCTCGCCTTTCATCACGAGGCCGATCTCGGTGGCGCG
CGGGTGGATGTGCGGCGGGTTGGTGCCCCCGGGCGCGAAGTCCACGCGGTTTCATGGAGATGCCCTGCGTGTTCTCGCCGGGGAACTCCGTCACGTCCAG
CCTCGTCACGGCCGAGCCGTTCGGGGTGGACGTGTTGCCGCCCTTGGCTAGCTTGGAGGAGAAGAGGAAGTCGTCGCCGGCTTCCGAC
page-top