Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv16n5m24
Contig Information
Length 795 bp
Tissue Shoot grown under cold condition for 16days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv16n5m24   
Homology (BLAST) Top Hit hypothetical protein OsI_31410 [Oryza sativa Indica Group] (no hit)
Score 264
Evalue 1.65027e-21
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whv16n5m24
CGCCGCCAGCGGTCCATGGGCAAGTCAAGCAAGAAGTCCGCGGCCCCTACTGTCGTGGCGCCGGCGGCCGTCCTTACCAAGGGGAAGGCCGGGAAGAAGC
GCGAAGCCGATGACGAGATCAAGAAGGCTGTAAGCGCAAAGAAACAGAAGGCTGCGCCGGCAAAGGCGGTGCCCGGGCCCAAAGAGGCCGCCAAGAAGGC
CAAGAAGCAGCCGCCGCCCAAGAAGGTTGAGAGCAGCAGCTCTGAGGAGCAGTCATCCGAGTCCGAGGAGGAGGAGGTTCCTAAGAAGACTGCAAAGCCT
GTCAAACACGAGTCTTCAGATGATAGCAGCGACGATTCCTCCTCTGACGAGGAACCTGCAAAGAAGCCTTCTGCTAAACCTGTGACCCCAGCTGCCAGCA
ACGGCTCAAAGAAAGGCAAGCCTGAGAGCAGCTCTTCTAGTTCTGAGGATGAGTCCGATGATGACGAGAAACCTGCTGCTCTGGTAAAGAAAACACCAGT
CATCGAATCTGACAGCTCCGAAAGTGACTCAGATGATAGCTCAGATGAGGATGTTCCTGCCAAGACTCCTGCTGCTGCTGCCAAGAAGGTAGATTCTTCA
GACAGTTCTGAGTCGGAGAGTGAATCTGAGGATGAGGAGAAGTCAAAGAAAGCCGCACAGGCCACCAAGATAGCTCCTGCAGCTGCTAAAAGAAAGGAGG
AGCCCAGTGATTCCTCANACAGTGATGAGAGTGATGAAGAGCCTCCCCANAAAAAGCTGAAGGATGCTGCGAAGGTTACTCCTAAGTCTGCCAAA
page-top