Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv16n1d07
Contig Information
Length 209 bp
Tissue Shoot grown under cold condition for 16days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv16n1d07   
Homology (BLAST) Top Hit hypothetical protein OsI_32437 [Oryza sativa Indica Group] >gi|125606675|gb|EAZ45711.1| hypothetical protein OsJ_029194 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 287
Evalue 1.58233e-24
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whv16n1d07
ATTCTGAATTCTCTCATTTCTTAAATTAAATTTGGTTAATATTTATTAACCCCATAAAAAAGAAATAATAAAGGCCATTTCTTCTAAAAAATTAGAATAG
TGAGACGTATTAAAACGCAATTTGCGTTCCGAATTGCTAGCTCTTCTCTTTCAGTATTATGAAATTCCATTCCCATTAGAATATTCATTGACAGATAATA
AAAAAAAAA
page-top