Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1728
Contig Information
Length 613 bp
Tissue Seed DPA20
Clones 3 Clones [Download: CSV  ,  FASTA ]
whdp16i05    rwhdp10f07    rwhdp16i05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit early nodulin protein [Brachypodium sylvaticum]
Score 333
Evalue 1.37844e-29
Total Hit Count 64
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1728
TTTTTTTTTTGTACAAATGCAAGTTATTATTAATTCAAGATCACTGGCTGGATACATGATGATTACTTGATCAGATAAGTGCTAATTGCACGCAGAGAAG
ACCAGTACACTACACCACTCACTGTCTGCAAGCCTAGCCTGATCTCAGATAATTGCTGAACATTATACTAGTGCTAGTATCCTTCAGCAGACACGTGCAG
GCCGGCATGCAGTTTATTGCACACTGCTACTAATGGGTCTATTACAGTCTAATTAGTGGAAGGAGGTGTTCTTGAGGTGCTCCGGCGCGTCCTCGTAGGA
GTGCTTCCTGGCCATTGATACGATGGTCTTGTCGGCGACGATGAAGTAGGCCATCCCGGCGACGGTGGAGATGATGAGCGCCTGCCCGGTGGGGTTGAGG
TGCGCCCTCGCCCACGGCAGCATCCTCACGCTCGCCAGGGTGGGGACTGCGGTTGCAACGGTGGCGACGGCGGCCGCCTTGGCTCCCGCAATGGCTGCCT
CTCTGGAGCAGCGCTTGGCGGCGGCGAGCCTTTGGTCGAGGTGGGCTCGGGTTACGGTACACATCTTCGCAGGAGCAGAGCTTGGTGGCGCGAGATCGCA
AGGAAATGAACCG
page-top