Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsd12g09
Contig Information
Length 719 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsd12g09   
Homology (BLAST) Top Hit Os11g0143500 [Oryza sativa (japonica cultivar-group)] >gi|113644428|dbj|BAF27569.1| Os11g0143500 [Oryza sativa (japonica cultivar-group)]
Score 733
Evalue 8.14792e-76
Total Hit Count 270
Registered year 2003
Contig Sequence     [ Download ]
>whsd12g09
CGCCGCGCACCCACTCCCGCTCCCCACGATGCGGCACCTCCTCCTCTCCCGTCTCNTCCGCCGCGCCTCCTCCCCCTCCCAGCCTCACCACAACCTCCAA
CTCATCCGTGCTCTCTCCTCCTCCTCNCCTCTCCCGGCCTCCGACACCGACCTCCGCAAGTACGCCGGCTACGCGCTCCTCGTCCTCGGCTGCGGCGCCG
CCACCTACTACTCCTTCCCCTTCCCANCCGACGCGCTCCACAAGAAGGCCGTCCCCTTCAAGTACGCGCCCCTCCCCGACGACCTCCACACCGTCTCCAA
CTGGAGCGGCACTCACGAGGTCCACACCCGCGTCCTCCTCCAGCCCGACTCCATCCCGGCGCTCGAGGATGCCCTCGCCACAGCCCACAGGGAGCGACGC
AGGCTCAGGCCCCTCGGCTCCGGGCTGTCCCCCAATGGCCTCGGGCTCTNCCGGGCCGGCATGGNCAACCTTGCGCTCATGGACAAGGTGCTAGACGTNG
ATGTCAAGAAGAAGACCGTCACGGTGCAGGCTGGGATACGTGTCGCCGAGCTCGTCGATGCGCTCAGCAAGCATGGGCTCACACTGCAGAACTTTGCCTC
CATTCGAGAGCAGCAGGTCGGCGGCATCATTCAGGTTGGTGCCCATGGTACTGGTGCGAGATTGCCTCCAATTGATGAGCAGGTTATTAGCATGAAACTG
GTTACTCCTGCCAAAGGGA
page-top