Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsd4n19
Contig Information
Length 732 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsd4n19   
Homology (BLAST) Top Hit hypothetical protein OsJ_005360 [Oryza sativa (japonica cultivar-group)]
Score 939
Evalue 1.1057e-99
Total Hit Count 134
Registered year 2003
Contig Sequence     [ Download ]
>whsd4n19
TGATGGTCTTCAAGGGAATTGCCTTCATGCCTTCCCATACTTGTTGATAGGATGGGCAATGAAATTACACGACTTACGGCGGTCAAGGCATTTGCGGTGA
TTGCAAATTCACCTCTTCGTATTGATCTTTCATGTGTCTTGGACCATGTCGTTTCTGAGCTCACAGCTTTCCTTCGAAAGGCCAACAGAGCCCTTAGGCA
GGCAACATTGGGAACCCTAAATTCTCTGGTTGTCACATATGGGAGTCAAATTGGCTCGTCCTCTTATGAAACGATATTAGCTGAACTTTCTACTCTCATA
AGTGACGGCGATTTGCATATGGCCGCTCTAGCATTGGAACTGTGTTGCACAATAATGGTCGACAGAAGATCCGTTAAAAATGTTGGTTTAGCTGTGAAAC
AAAAAGTTTTGCCTGAGGCCCTTACTTTGATCAGGAGTGCTCTGTTGCAAGGACAAGCACTGCAGGCGCTACAGAAGTTTTTTGCTGCACTGGTCCAATC
TGCAAATATAAGCTTTGAAACTTTGTTGAACTCCCTTATTTCTACTGCTAAACCATCACAGTCAGGCGGTCTTTCCAAGCAGGCACTATTCTCTATTGCA
CAGTGTGTTGCTGTGCTATGCCTAGCAGCTGGTGATCAGAAGTGTGCATCAACTATTGAAATGCTTAAAGGCATTCTTAATGATGACAGCTCTACTAATT
CTGCTAAACAACACATGGCCTNGTTATGTTTG
page-top