Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1636
Contig Information
Length 532 bp
Tissue Seed DPA20
Clones 3 Clones [Download: CSV  ,  FASTA ]
whdp4k23    rwhdp4k21    rwhdp4k23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0332400 [Oryza sativa (japonica cultivar-group)] >gi|108707977|gb|ABF95772.1| Hydroxyacylglutathione hydrolase, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548487|dbj|BAF11930.1| Os03g0332400 [Oryza sativa (japonica cultivar-group)] >gi|215736998|dbj|BAG95927.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218192761|gb|EEC75188.1| hypothetical protein OsI_11422 [Oryza sativa Indica Group]
Score 348
Evalue 1.73205e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1636
TTTTTTTTTTCCAACCATCACAGACTTCAGATATACACAAGACATTCTGCCACAGGCCAACATAGTTTTTGTTTGTTTTGCCAAGAAATAACATACCAGT
AGTAATTAACATGCCACAACAGTTGTATTCTGATTGATACCAAAGCATATTAGCAGACTGGACTCCTTTCTCTTATGTTTTTCTTAAAGGAAACACTGGC
ATATTATCTTCTTAACACGTACGTAGCTCTCAAAGCATCGCACGGCTGTAAACGCCACCTACAAGTATGAGTGGCAGCTGCGTTTATCAACCTTTCCAGG
TATCCTTGATGTTCCTGACCGTCCTCAGCGCTTCAACTGCCGACTTGGCACCAAATTTTGCCTGTATTTCAGGCAGATCAACACGCATGAAGGTGTTTAT
CTCAAGCTCATCTCCTATAGTTGAGGGAACCGTCGGTTGATTTGCTTCACGCTGCTTTTGAGCCCATTCCAGTTTCTGCTTCATTTTTTCGTTCTCTGGC
TCGACTGTCAGCATGAATTGTAGGCTCTTTAC
page-top