Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsd20a15
Contig Information
Length 634 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsd20a15   
Homology (BLAST) Top Hit Os02g0549600 [Oryza sativa (japonica cultivar-group)] >gi|115458432|ref|NP_001052816.1| Os04g0430100 [Oryza sativa (japonica cultivar-group)] >gi|109940154|sp|Q9AYP4|RS10_ORYSJ RecName: Full=40S ribosomal protein S10 >gi|21740815|emb|CAD41005.1| OSJNBa0042L16.19 [Oryza sativa (japonica cultivar-group)] >gi|46390693|dbj|BAD16194.1| 40S ribosomal protein S10 [Oryza sativa Japonica Group] >gi|50725745|dbj|BAD33256.1| 40S ribosomal protein S10 [Oryza sativa Japonica Group] >gi|113536619|dbj|BAF09002.1| Os02g0549600 [Oryza sativa (japonica cultivar-group)] >gi|113564387|dbj|BAF14730.1| Os04g0430100 [Oryza sativa (japonica cultivar-group)] >gi|116309307|emb|CAH66395.1| B0222C05.3 [Oryza sativa (indica cultivar-group)] >gi|125582462|gb|EAZ23393.1| hypothetical protein OsJ_006876 [Oryza sativa (japonica cultivar-group)] >gi|125590427|gb|EAZ30777.1| hypothetical protein OsJ_014260 [Oryza sativa (japonica cultivar-group)] >gi|215694841|dbj|BAG90032.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218190943|gb|EEC73370.1| hypothetical protein OsI_07603 [Oryza sativa Indica Group] >gi|218194864|gb|EEC77291.1| hypothetical protein OsI_15930 [Oryza sativa Indica Group]
Score 495
Evalue 2.47268e-48
Total Hit Count 309
Registered year 2003
Contig Sequence     [ Download ]
>whsd20a15
CGCCGCCTCCTCTCTCGTCCCGGCGCGCTTGGAGCTCGACCTACCCGCGCGCCGCCCACTATGATCATCTCCAAGAAGAACCGCAATGAGATCTGCAAGT
ACCTCTTCCAAGAGGGGGTGCTGTATGCCAAGAAAGACTACAACCTGGCGAAGCACCCGCAGATTGACGTGCCGAACCTCCAGGTGATCAAGCTCATGCA
GAGCTTCAAGTCTAAGGAATACGTCAGGGAGACCTTCTCGTGGCAGCATTACTATTGGTACCTCACCAACGATGGCATCGAGTTCCTGCGCAACTTCCTC
AACCTGCCATCTGAGATCGTGCCTGCCACGCTCAAGAAGTCTGCCAGGCCTCCTGGCCGCCCACTCGGTTCTGGCCCACCTGGTGACCGCCCAAGGGGGC
CACCTCGCTTTGAGGGCGACAGGCCTAGGTATGGTGACAGGGATGGCTACCGTGGCGGTCCTCGTGGTGCACCTGGTGACTTTGGTGGTGAGAAAGGTGG
AGCCCCTGCAGAGTTCCAGCCATCATTCAGGAGCTCTGGTGGTGGCGGCTTTGGCCGTGGTGGTGGTGGTGGTGGCTTTGGCCGTGGTGGCGGCGGCGGT
GGCTTTGGCACTGGCCCAATGGANTGAACTTTCC
page-top