Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsd10b15
Contig Information
Length 765 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd10b15   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194708104|gb|ACF88136.1| unknown [Zea mays]
Score 875
Evalue 4.54433e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsd10b15
ATGGGAACACACTGGGAATGACTAATGCACATACACTCTCATCAGTTTAACAAGTCTCGCAAGTTCCACATATATTAAGCTGTTTACAGTATGCACTAGA
ACAAAGACGCCACACAACATCGTTCCTAAAAGCATTTGTGAGCGGTGAGCTCACATGACGATCTCAGGCTTCAGGATGCTTGACTTGATCTCCTTGTGTG
GGAGAACAACACCGCCGTTGCTGTAGACCTCGTCACCTACATGTACGTCTTCTCCCAGGATAGTCATATTCTCTATGCGTGCCCATTGTCCAACCGTCGA
ATGCCAGCCGATAATGCTGTTTGAGATGCACGCATGCTTCTTAATGCGCACACCGCGCATCACCGTGCATCGGGAGAGCCTCACACCATCCTCCACGACG
CATCCAGGTCCAATAGCAACATCAGGACCAATCAGGCAACCCTCCCCAATCTTGGCGCTCTCGTGCACCAGGACGTTCCCAACAACATGTGCTCCAGCGG
CCAGCTTGGCAGCTGATTTCTTCCTAAGTGAATCTAGGTAGAGACGCAAGCCAGTGATGTAGTCCCTTGGCTGGCCAATATCCATCCAAAAGCCTGGAAG
GACCATGGCGTAGAGCTTCTGATCAGCTGCAATTCGAGGGAAGACCTCCTTCTCGATTGAAGTTGGCTTTANCTCGATGCGGTCCAGCACAGACGGATTT
AACAAGTAATTCCTGCATTGATCTTGTTGCCTACAAATATCTTTGGCTTCTCTACAAATCTTTCC
page-top