Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsd10c08
Contig Information
Length 785 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd10c08   
Homology (BLAST) Top Hit hypothetical protein OsI_13865 [Oryza sativa Indica Group]
Score 878
Evalue 1.48751e-92
Total Hit Count 79
Registered year 2003
Contig Sequence     [ Download ]
>rwhsd10c08
CTTCGCTTATCACAGGTTCATGTCCATCCGATGAGGACTGATACAACAACATCGAGGATCTTCGCGAGATTCTTTACAATTAGAATAGCGTGCCGCCAAC
CAAAAGAGGCCGGGCCAGTGCCAGCACCCAGCCAATTGCGCTCGAAACCTAGATAATAAGGTTGACGCGGAGTTTGTTCTGTCTCGAACTCTCTTCTGGC
TCCAGTGGTAAAACTCGGGTGATTTCGCGCCATCGAGCTCAAGTACGCCGTCAACACGCGGTTCGCCCGTAGCAGATCGAGGCGATGTACAGGTTCTTCG
CCCATTTTTCCTTCACGTGGTTACTGGGGAAGGCAGAAGTTCGAAGGGTTTCCTGGGTCTCGTCCAGTGGCTTCCTCTTTGGTATGCTCAAGATAAAAGC
AGCTTGGTCAGGTGTGCCTGCCGATGAAGTTATTCTGTAACCACTCTCCCATCGCCGATGGAGTCCTTCACTTGGATACAGAAAATCCAACTCTACAACC
TGGTCAGAGTAGCCCGCATTCCTTGACATGACAACTCCCCAACGGTTCCCAGCAGTACCCATGGATGTTACATGAAAACCTTCTTTCCACTTTTTATTAA
TCCACTTATAAGGAAAAGATTCACTGACTTTGTATGACTGCTGTGTGTACGGAGTTCCTTTGGACATCACAACCAATGAGCTTCCATTGGTTGCTCCAGC
TATTGCTGTTATATAGAAGTTCTTTTCCCATTGCTCCATAATCCAATCCTTGTGCAGGAAATTTNGTGAAAGCTCATACACTTGA
page-top