Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsd10c10
Contig Information
Length 547 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd10c10   
Homology (BLAST) Top Hit Acyl-CoA-binding protein [Panax ginseng]
Score 280
Evalue 1.45958e-23
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsd10c10
AGAAGACATGTAGGAGTATTAATCAATCATGGTGTAAACTGAGATTGCACTTTCATGTATCACAGGGCTTGTTCAACGTAATTACACCCACGACGGCGAT
AAGCTTGACAACAACTAGTACTTGAAACTTATTTGTGTTTGCTGGCACATATGGCTGCACCACCAGGATAACAATAGCGATTGCGGTTTTGTGGCCTGGG
ATCAAGCAGATGCGGCAGCAGCCTCCTCCAGCAGCTGCTTCACCTTGGTGATGTAGTCAGCCATGGCCTCCTCCTTGGATTTGGCTTCGACGGCCTTCCA
AGCATCCCACTTGGCCTTGCCAGCCATATCAAAGAGGCCGCCGGGGCGGGCGGTGTTGACGGGGCCGACGGTGGCCTGCTTGTAGAGGCCGTAGAGGCAG
AGCTTGCTCTCGTTGGTGGTGGTGTCGGGCAGCGTCTTGGCCTTCTCCGCGTGCTCCTCAAACTCCTCCTTGAGACCCATGTCGATCGTCTGCTCTCCTC
GGCTTCGATACGTTCGAGGCGATCGATGCGATGCGATGCGAGGCGAG
page-top