Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsd10c13
Contig Information
Length 688 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd10c13   
Homology (BLAST) Top Hit hypothetical protein OsI_04388 [Oryza sativa Indica Group]
Score 428
Evalue 1.72843e-40
Total Hit Count 495
Registered year 2003
Contig Sequence     [ Download ]
>rwhsd10c13
CAGGTGTATTTACAATTTGAATCAAGCAAATGAAAAAGGCTGACCATTACTGGCTGAGACGTTACTTGAAACATTACTGAATTGTACTCTGGAAGAACGA
ATATAATACAAGACTGACCATGCAAGAAGAACCTATATGCTACATCTAAACATAAGTAGCCTGCCCACCAAAAATGCTAACTGTTCCTGTGAAAACTAAC
CGTGCATAGGCAGCACATACAACAGGCAGATGCTACAGGAGAGTAATCAGGTTCATCATCTGCATCAACAAACAAATGAACCATGTCACTGGTGAACAAA
TGGTTGTCTCTTTGGTGCCGGTTCAAATAGCATTTTTACCTACTAATAGGTTGTTGGCCAGGAACAATCAGCTCTAGAGTCCAAAAATATGAACAGGTCA
CCATTTACAGAAGCTAGGAGGATTGGGGATTCGCCTTCCATGTTGAGAGCGCGTACAGGATACGCCCCTTCCATCCTTGTAGTAACCACCTGTTGTCCTC
GTCGATGATGAAATTCTTGTGGTAGCACTTCACCTTCTCCCGTGCACGCTTCATGATTTCCGGGTCCAGCGGGAGCTGCTTGAACCCAGCCCTCTGATTC
CGCACCTGCCACTGCTTGTAGGTCTCTGGCCTCTCCATCCTCTCCATTCCCTCACAAGATATGACATTAATTGCCTCCCGACTGAAAA
page-top