Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsd10c20
Contig Information
Length 728 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd10c20   
Homology (BLAST) Top Hit hypothetical protein OsI_17675 [Oryza sativa Indica Group]
Score 641
Evalue 3.89902e-65
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsd10c20
TATTTATGTTGTGTATAAATCGTCGCCATTCACCTAGCCCTCCGTCTCTTTACCTATTACAGTTTGAGTACAACACGCCGTCCAAGTGCATGGCAAAATA
CGAATGCGACAGTGGCCCAAAATGCCAAGATGAATGAAACGGCACTGACCACGTAAAGGATCGGGTCAGAATCATCAGCCACACTTCCTGCAACACCATT
TGCTGCCATGGGACCTGAACTTGAAGTGCATGATCTAAGGTTGTTGTTCCCTTTGTAACTGTCCATACCGAATGTGCTGAACTGACCGCTGGCTGGTAGA
CACCCCGATAAATTGTTGTATGCCACAGAAAACACCTCTAGGGATGATAGCCGAGTTAACTGCCATGGCACTGATCCGCTCAGCCTGTTTTCTGATAGGT
CTAAGCTCTCAATCTCGGTCAAGTTTGCAAAGGTTGCAGGGATAGAGCCAGTAAAGAAATTGTTCGACAAGTTGAGAGACTTGATGTGGCTCAAATTCCC
CATCTCCATCGGAATCTCGCCCGACAGCATGTTTGCAGACAAGTCAATGCCAGACATCGACATGAAGAAGTTGTGTCCGTATGTGTATGGTGGGTTCCCT
TTAGTGGTGAAGGTGAATCCTTGGAGTTCATAATCACTGTTATATGAGAAGCCCGTATCATCGAACACACCAAACCCCCCTCCAAAAGAGTTACTGGAGG
TTCTGGGCCAGTAAATGTATAAGCTTCA
page-top