Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsd10d06
Contig Information
Length 736 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd10d06   
Homology (BLAST) Top Hit hypothetical protein OsJ_034284 [Oryza sativa (japonica cultivar-group)]
Score 722
Evalue 1.622e-74
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>rwhsd10d06
GAAGTAGCATGTCCAGATACCATTGCTAACTCTCAATCATGAAAATGAACACACAGAACGAATCTACACGGCTGGAAAAACAAATCAATGCACATTTGTG
TGCAATAAAACTGTTCGCAGATCTAGTGGACATCGACAATATCCTTGTTACACTCGAACAGGTTTCCTTCTAATGACGCACTTAACAGAGAACGTGTCCT
GAAGTGATATGTCCATCTAGCAATAATTGAATCTCACTGCACACTTGCTTCCCTGTGGAACAGTGAACTTATTTCAATTCAGGAGCATATAGAGCAGGGC
AAGGTGATACGGTATGATCAGGCAAGCCACTTATGAACTCGTTAGCAGCCTGAAGACAGCCATGCAGCATTTTCTTCTCTAACCTTACAAGTCTAGTAGC
AACTTCTTTCTTTGGTTCCAAACTGCCATCGGCCAGCATTGCTTCATCCTCGTCCAAAGTAGTCGGATAACCAGCCAATCTTGATTTCAGGTAGACAACA
AGTTGGTCAAGTACAGCTCGCTCTGAGCATGGACTAACTGGACATGTATCACCTTCTGACGAAAGTATACATTGCATTTCATCTGGATCTGAAATGTATC
CTAGTCTCAAGTATGGCAGCATTTCAGAAATAGTTTCCTTCTCTTTGCCTACACAGACTTGGAATTTTTGGATAGCAAGCTTTCCATTTCTTTGAGCGAC
CATTCTCTTCTCTTGGTATTGAGGATCTTCAGTGTT
page-top