Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsd10d14
Contig Information
Length 781 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd10d14   
Homology (BLAST) Top Hit hypothetical protein OsI_02369 [Oryza sativa Indica Group]
Score 221
Evalue 2.25208e-16
Total Hit Count 140
Registered year 2003
Contig Sequence     [ Download ]
>rwhsd10d14
ATAACGATCTTGGACTCTGGTTCATAACAAACAGCAAATGAAAGCTCAATGTTACATAACAAACAACAGCTCAATCATAAAAGTTTTAACATGGATTGTT
TGTAGAATAGCAAATTCATCGTTCAAAGCCTTGTCACTTATCATCACCGTTCTGCACAGCTGCACTTGCGCGAGGGTCATCATCGGCTATCATACCCTCC
TCTCCCTCTTCATCTATCATACCTTCCTCTTCATCCTCCCTCTTCTTGCTGCTCACAGAGACTTCCACAGGTTTAGCATCCACCACTGGCTCGCCATTAG
GGCTCATTGAGCCCCTGCCTCCTTCGCCATTATACACAGGACTATATGGAGCAGACTTGTCATCCCGCTCCTGCAGACTGGGCGACCGATCCAGATCAAC
CTTTCCCATCTTCCCATCGCCATTTGAAGGGTCGACACTGCGGCTCTTGTGATCATTTGAAGGGTGAGCATTGGGTGAGCTTTTCTTCTCCACTGGGTGG
GCAGAGTCAGGACGTGCGGACCCAGAGTCAGCTCTTCTTTCAGTCTTGCGTCTAGCGCCAGGGCTACGACTCCTGCTGCGGCTAGCACGACGATTCCTAG
TGTAACTCCTGCTCCGGCTCCTGCTCCGGCTCCTGTTCCTGCTCTTGTTTCTGCTCCTGCTCCGGCTCCTGCTCCGGCTCCGACTTCTAGTCCTGCTACG
GCTAGCCTGCACATCATGGCGCCGTCTCTTGGGGCTTGGGCTGCGCCTATCACTGTCACTCCTGCTAAGGCTTCTGCTGCG
page-top