Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsd10f02
Contig Information
Length 747 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd10f02   
Homology (BLAST) Top Hit Os12g0193200 [Oryza sativa (japonica cultivar-group)] >gi|77553265|gb|ABA96061.1| mRNA capping enzyme, C-terminal domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113648852|dbj|BAF29364.1| Os12g0193200 [Oryza sativa (japonica cultivar-group)] >gi|215713423|dbj|BAG94560.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218186558|gb|EEC68985.1| hypothetical protein OsI_37750 [Oryza sativa Indica Group]
Score 744
Evalue 4.61867e-77
Total Hit Count 168
Registered year 2003
Contig Sequence     [ Download ]
>rwhsd10f02
TGATAATGATATCAAGCATTGGTGACACACAATAAGAGATATACAGGACTCTGGAACAATACATGTACAATGGCCAATATGACAAAGCATTGAAAAACTT
GTGTAATGACCACTATTGTTTAATTGAAATCAAAAATTGATTATTGCTAAATACACAGGCTATAGAGGCCAGCCGGCATTGATGGTTCTAGTTTAAAAGA
CCAAGATTATTCGCCTTATCCCCTCCTTCTGTGCTGGTGAGCCAGCTTCTCGGCCTGGGCCTTCCTGTCAGCATGGGCCTTCCTGTCGGCGTACATTGGA
AGGCTACTGATCTCATTCATCTCGCCCAGGAGCTTGTCTTCAGTAATGTTATCTGTGATGCTCCTCATCACCTTTCTGTAAGTATTGATATCATTAGGAG
TTGATTTATCGGCTCGGATTCGCATGCAGAACCAGCAGTCCTCCTGTTTATTCCAAGAGCACTCAACAATTTTCCCTGATATTGAAGATGGCTCTACATC
ATCAGCAAATACCACCCGGGTACCATCCATAAGTTTCTTTTTGCCCCTCTCGTACAGAAAAATAAGCTGACGGTTTTCACTACCAGTCTCAAACAAAAAG
TCAACTGAATTCATCTCTGGGTACTTCCATTTTAAAAGACCTTCATGCGTACGATTCACGTATGGATCATCCCAGCCCTGAAATATAAGCCCATCAGATT
CATGTGAAAGTGCTGGAATAAACTCCTTGAGTAATTTCTTCACCGTG
page-top