Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsd10f10
Contig Information
Length 748 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd10f10   
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 215
Evalue 1.02165e-15
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsd10f10
ACATAGAGTAGCAGTCTTACATCCTACAAAGACTTATACCTATAGAGATGATGGACTGCAGAGCCTAAATTTTCTAAACTCAAGCATCCACAAAATGAAA
TCATCTCATGATGATGATGAATGATAACCACTAAACATAACTATTCGACTAAAATTTTAATTATGAAAGAGATGACAGCAGGCCGATGATCTGAACTACA
ACCGAGGAGTTCTTTCCTCCCTCTTTCTCTAAATTACATGTCTACAAATAAGTTTCAGAACAACAGGAATGGCATGGAATTCCAGTGAATGAAAATGAAT
AAATTATGGCTGACATCTCTGTTTCACCTTCGAAGCTGTATCTCACAAGTTGACTATAACCATTCTAGATGCTCATAATCTTTGGAAGTCCATCAAGCTT
TGCAGCATGTACAAACTGCATTACTCCGTACGTGGTTTCATTGGAAACACCGATATATTGTACCTTCCCTTTACCAATTAGTTCCTGAAAGCTTTCCATT
GATCCACACATGGGACGCTTGGCCTCCATTTGGTTGAATTGTAACTGAATTCACCGTAACGTGCGACATACCTATCTAGCCTGAAGACATAAAGCAAACT
TTGGAGCCAAAGTTGTCTTTTTTGTCAAATAAAATAATAATGATGACATATTAATACAAAGTATGAAAAATTCTATGTGAAAAATGAAAGAATTAACATG
AAGAATGTGTGCTGAAAACAGTCTGTATAAGACGACNAAAGGACTCNC
page-top