Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsd10b15
Contig Information
Length 229 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsd10b15   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194708104|gb|ACF88136.1| unknown [Zea mays]
Score 110
Evalue 0.000531173
Total Hit Count 381
Registered year 2003
Contig Sequence     [ Download ]
>whsd10b15
GGGTACCACTGCATATTCTCTTCCCGGGTCTTGACGAGGGGCAAGAAACAGGCGACCGACCGGCCAAAACAAGGTCGCTCGGCGCTGCTTCCGAATCTGA
CCCCGTCGGCTCCTCCTTCCTCATCCAGGGATCAGTGGGGAGTAAGAAGGGGGACGCCTCGCCATGAAGGCGCTCATCCTCGTCGGGGGCTTCGGGACCC
GCCTACGGCCTCTCACGCTCAGCTTCCCC
page-top