Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsd10c03
Contig Information
Length 713 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsd10c03   
Homology (BLAST) Top Hit Os03g0654400 [Oryza sativa (japonica cultivar-group)] >gi|29244640|gb|AAO73233.1| putative cationic amino acid transporter [Oryza sativa (japonica cultivar-group)] >gi|50582770|gb|AAT78840.1| putative amino acid permease [Oryza sativa (japonica cultivar-group)] >gi|108710158|gb|ABF97953.1| Amino acid permease family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549267|dbj|BAF12710.1| Os03g0654400 [Oryza sativa (japonica cultivar-group)] >gi|215694778|dbj|BAG89969.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218193418|gb|EEC75845.1| hypothetical protein OsI_12843 [Oryza sativa Indica Group]
Score 845
Evalue 8.23733e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whsd10c03
TACCCCTATTTCATCCGCCTTCGCGAGGCATGGGATGCAGTGGGCAATGTACCTTGTAACATCTGGTGCCGTTCTCGCTCTCTGCTCAACCTTGATGGGA
TCACTTCTGCCACAGCCAAGGATATTGATGGCCATGGCGAGAGATGGGCTGTTGCCATCCTTCTTCTCTGATGTTAGCGAAAAGACACAAGTTCCTGTCA
AGAGCACAATCATAACTGGCATCTGCGCGGCTTCTCTGGCTTTCTTCATGGATGTTTCACAACTAGCAGGAATGGTCAGTGTAGGCACGCTCCTCGCGTT
CACCATAGTCGCCGTCTCCATTTTGATCCTCAGATATGTTCCTCCAGATGAGGTACCCCTGCCATCCTCTCTGCAAACGTCGTTCCGCTTAAGCCAAGAA
TGTGATGAGGAAAAGGTGGGGAGTCCTCTTGGAGATGGGAACCATGAACAGGGGACGTCTGAGATTAAGGATGTGATCGTAGTAGAATCAATCAATGACC
CTCTTATTGAGAAGCAGCTATATGCAAACAAATTGGATGAGTTAAACCGGCGGAAAACCGCTGCTCGCAGCATAGCATCTGTATGCGTAGGGGTGCTAAT
CCTGACGGCTTCAGCTTCTGTAACGTTCCTGCCATTCCTGGTGATGTGCTTATTCTGCGTGTTTGGTGGCCTGCTCCTCCTAGCTGGTCTCGGAATGCTC
TCCTGGATCGACC
page-top